|
ATCC
gtgaaaccccgtctctactaaaaatacaaaaa Gtgaaaccccgtctctactaaaaatacaaaaa, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gtgaaaccccgtctctactaaaaatacaaaaa/product/ATCC Average 90 stars, based on 1 article reviews
gtgaaaccccgtctctactaaaaatacaaaaa - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Developmental Studies Hybridoma Bank
anti connexin 32 Anti Connexin 32, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti connexin 32/product/Developmental Studies Hybridoma Bank Average 93 stars, based on 1 article reviews
anti connexin 32 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
R&D Systems
il32β ![]() Il32β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il32β/product/R&D Systems Average 93 stars, based on 1 article reviews
il32β - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
taaatggacgccacgatcac 18s eukaryote x03205 1 applied biosystems gene expression assay endogenous control vic label trypsin digest ![]() Taaatggacgccacgatcac 18s Eukaryote X03205 1 Applied Biosystems Gene Expression Assay Endogenous Control Vic Label Trypsin Digest, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taaatggacgccacgatcac 18s eukaryote x03205 1 applied biosystems gene expression assay endogenous control vic label trypsin digest/product/Thermo Fisher Average 99 stars, based on 1 article reviews
taaatggacgccacgatcac 18s eukaryote x03205 1 applied biosystems gene expression assay endogenous control vic label trypsin digest - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
|
DeGussa Corporation
aerosil mox80 (bet surface area 80±20 g/m2, average primary particle size 30 nm, sio2 content >98.3%, al2o3 content 0.3-1.3%) ![]() Aerosil Mox80 (Bet Surface Area 80±20 G/M2, Average Primary Particle Size 30 Nm, Sio2 Content >98.3%, Al2o3 Content 0.3 1.3%), supplied by DeGussa Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aerosil mox80 (bet surface area 80±20 g/m2, average primary particle size 30 nm, sio2 content >98.3%, al2o3 content 0.3-1.3%)/product/DeGussa Corporation Average 90 stars, based on 1 article reviews
aerosil mox80 (bet surface area 80±20 g/m2, average primary particle size 30 nm, sio2 content >98.3%, al2o3 content 0.3-1.3%) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Revvity
il 6 activity ![]() Il 6 Activity, supplied by Revvity, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il 6 activity/product/Revvity Average 98 stars, based on 1 article reviews
il 6 activity - by Bioz Stars,
2026-06
98/100 stars
|
Buy from Supplier |
|
Chem Impex International
linker 4 formylphenyl sulfonyl l isoleucine ![]() Linker 4 Formylphenyl Sulfonyl L Isoleucine, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/linker 4 formylphenyl sulfonyl l isoleucine/product/Chem Impex International Average 95 stars, based on 1 article reviews
linker 4 formylphenyl sulfonyl l isoleucine - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
|
R&D Systems
il 32b ![]() Il 32b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il 32b/product/R&D Systems Average 94 stars, based on 1 article reviews
il 32b - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Nippon Aerosil Co Ltd
sio2 bet surface area 295 m2 g-1 ![]() Sio2 Bet Surface Area 295 M2 G 1, supplied by Nippon Aerosil Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sio2 bet surface area 295 m2 g-1/product/Nippon Aerosil Co Ltd Average 90 stars, based on 1 article reviews
sio2 bet surface area 295 m2 g-1 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Nippon Aerosil Co Ltd
aerosil® 300 ![]() Aerosil® 300, supplied by Nippon Aerosil Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aerosil® 300/product/Nippon Aerosil Co Ltd Average 90 stars, based on 1 article reviews
aerosil® 300 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ppp1r1b hs00938414 m1 ![]() Gene Exp Ppp1r1b Hs00938414 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp ppp1r1b hs00938414 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp ppp1r1b hs00938414 m1 - by Bioz Stars,
2026-06
85/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp ppp1r1b hs00938410 m1 ![]() Gene Exp Ppp1r1b Hs00938410 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp ppp1r1b hs00938410 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp ppp1r1b hs00938410 m1 - by Bioz Stars,
2026-06
85/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: IL-32β is the most dominant isoform in HepG2+LX-2 spheroids that increases neutral fat content, and IL32 downregulation lowers neutral fat in 2D cultured hepatocytes (A) To test the effect of IL-32 administration on intracellular fat content, immortalized human hepatic cell lines HepG2 and HepaRG were cultured in 2D and incubated with human recombinant IL-32α, IL-32β or IL-32γ isoform for 48 h. Then, intracellular neutral fat content was visualized by Oil Red O staining (ORO). ORO area quantified per DAPI stained nuclei by ImageJ, showed increased intracellular neutral fat content in both (A) HepG2 (top) and HepaRG (bottom). (B) To test the effect of IL32 downregulation on intracellular fat content, 24 h after seeding, cells were transfected with scramble or IL32 siRNA and grown in regular medium without FBS (HepG2) or medium supplemented with 25 μM oleic acid (HepaRG) for an additional 48 h. The average of gene knockdown efficiency was ∼70%–75% as evaluated by real-time qPCR analyzed by the 2 −ΔΔCt method. Intracellular neutral fat content was visualized by Oil Red O staining (ORO). ORO area quantified per DAPI stained nuclei by ImageJ showed lower intracellular neutral fat content in both HepG2 (left) and HepaRG (right). Two-sided p values were calculated by the Mann-Whitney non-parametric t test. Data shown as mean ± SD in all groups for the reported number of experiments. (C) HepG2+LX-2 cells were cultured as spheroids for 96 h exposing them to medium supplemented with 1% BSA or to increasing concentrations of a mixture of fatty acids (PA + OA, 1:2). IL32 gene expression measured after exposure, demonstrated higher IL32 mRNA levels with increasing intra-spheroidal triglyceride levels. The p value was calculated by test for linear trend. Data shown as mean ± SD for the reported number of experiments. (D) Percentage of IL32 gene products versus other IL-32 isoforms was measured from RNA sequencing (RNA-seq) data and IL-32β is the most dominantly expressed IL32 isoform in our spheroid model. The p value was calculated by one-way ANOVA. OA, oleic acid; PA, palmitic acid; RU, relative unit.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Cell Culture, Incubation, Recombinant, Staining, Transfection, Knockdown, MANN-WHITNEY, Gene Expression, RNA Sequencing
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: Incubation with human recombinant IL-32β increases while IL32 downregulation lowers intracellular triglyceride content in spheroids from immortalized and human primary hepatocytes (A) HepG2+LX-2 cells were cultured as spheroids for a total of 96 h. Initially, 48 h after seeding cells the media was supplemented with 25 nM IL-32β for 48 h. (B) HepG2+LX-2 spheroids were generated by seeding cells along with negative control (SCR) siRNA or 30 nM IL32 siRNA transfection mix for downregulation for total of 96 h. (C) Primary human hepatocytes (PHH) were cultured as spheroids for a total of 7 days. Initially, 48 h after seeding the media was supplemented with 25 nM IL-32β for an additional 5 days with media replacement every 48 h. (D) PHH were cultured as spheroids along with negative control (SCR) siRNA or 30 nM IL32 siRNA transfection mix for downregulation, for a total of 7 days. For both spheroid models, cellular ATP levels (marker of viability) remained stable between the experimental groups. The average of gene knockdown efficiency was ∼70%–75% as evaluated by real-time qPCR analyzed by the 2 −ΔΔCt method, relative to beta-actin. Intracellular neutral fat content measured by Oil Red O staining and AdipoRed assay showed an increase in triglycerides content after incubation with IL-32β while IL32 downregulation lowers triglyceride levels. Two-sided p values were calculated by Mann-Whitney non-parametric t test. Data shown as mean ± SD in all groups for the reported number of experiments. RFU, relative fluorescence unit; RU, relative unit (to beta-actin); SCR, scramble siRNA; untr, untreated.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Incubation, Recombinant, Cell Culture, Generated, Negative Control, Transfection, Marker, Knockdown, Staining, MANN-WHITNEY, Fluorescence
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: IL32 downregulation lowers intracellular COL1A1, increases MMP2 levels, and lowers TIMP2 in primary di-lineage human spheroids Primary human hepatocytes and primary hepatic stellate cells, at the ratio 24:1, were seeded with negative control scramble (SCR) and IL32 siRNA, at 5,000 cells/well in ultra-low attachment 96-well U-bottom ultra-low attachment plates. Fifty percent of the total media was replenished with fresh media every 48 h. (A) After 7 days of formation, spheroids were collected and 8-μM sections were subjected to immunofluorescent staining for COL1A1. Immunofluorescence was quantified by ImageJ, normalized to number of DAPI stained nuclei. The knockdown efficiency was measured by real-time qPCR, relative to beta-actin. (B) MMP2, TIMP-1, TIMP-2, and α-SMA protein levels were measured by western blotting in the cell lysate. Calnexin was used as loading control. Representative images of protein levels are shown. For each panel, data shown as mean ± SD of the reported independent experiments. Two-sided p values were calculated by Mann-Whitney non-parametric test. COL1A1, collagen Iα1; MMP2, matrix metallopeptidase 2; TIMP1, tissue inhibitor of metalloproteinase 1; TIMP2, tissue inhibitor of metalloproteinase 2.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Negative Control, Staining, Immunofluorescence, Knockdown, Western Blot, Control, MANN-WHITNEY
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: Endogenous IL32 downregulation lowers, and incubation with recombinant IL-32 β increases, intracellular triglycerides synthesis For endogenous IL32 downregulation experiments, HepG2+LX-2 spheroids were generated by seeding cells along with negative control (SCR) siRNA or IL32 siRNA transfection mix for a total of 96 h. For IL-32β incubation experiments, initially, 48 h after seeding HepG2+LX2 cells (24:1), the media was supplemented with 25 nM IL-32β for another 48 h. In both conditions, newly synthesized triglycerides were separated by TLC and quantified by scintillation counting after incubation with 6 μCi/mL 3 H-glycerol plus 1.5 mM glycerol for 12 h. (A) Reduction in de novo triglyceride synthesis after IL-32 downregulation. (D) Increase in de novo triglyceride synthesis after 25 nM IL-32β incubation. Cells were incubated with 8.5 μCi/mL 3 H-palmitate +55 μM/L palmitic acid for 6 h, after which palmitate was precipitated with BSA and perchloric acid and quantified by scintillation counting. (B and E) Graph shows no difference in beta oxidation in both experimental groups. APOB-100 synthesis and secretion levels were measured by immunoblotting. (C) Decrease in APOB-100 in cell lysate and cell culture supernatant after IL-32 downregulation. (F) No changes in APOB-100 levels in cell lysate and culture medium, after incubation with 25 nM IL-32β. The reported number of experiments were performed independently. Representative blots are presented. For all experiments, two-sided p value was calculated by Mann-Whitney non-parametric t test. Data shown as mean ± SD. AU, arbitrary units; DPM, disintegrations per minute; TAG, triacylglycerol.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Incubation, Recombinant, Generated, Negative Control, Transfection, Synthesized, Western Blot, Cell Culture, MANN-WHITNEY
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: Differentially expressed genes reveals downregulation of key genes for lipid metabolism in HepG2+LX2 spheroids (A) Key genes of lipid metabolism differentially expressed in spheroids after IL32 downregulation as compared with scramble. (B) Top 100 differentially expressed genes after IL32 downregulation as compared with scramble. Data are presented as log2-fold change in expression and –log 10 of p values adjusted using the Benjamini and Hochberg’s approach for controlling the false discovery rate (FDR). VLDL, very low-density lipoprotein.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Expressing
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: Co-downregulation of PLA2G2A and IL32 abolished the IL-32-mediated intracellular triglycerides lowering and IL32 downregulation reduces intracellular PI levels in human primary spheroids Primary human hepatocytes were cultured as spheroids and incubated with negative control (SCR) siRNA or 30 nM IL32 , and combination of IL32 and PLA2G2A for a total of 7 days. (A) Cellular ATP levels (marker of viability) were not different within the three groups. There was an 80%^–90% reduction in mRNA levels of IL32 and PLA2G2A , relative to beta-actin. Intracellular neutral lipid content (measured by Oil Red O staining) normalized to nuclei (stained by DAPI) were lower after IL32 downregulation while the co-downregulation of PLA2G2A and IL32 abolished this reduction. (B) IL32 downregulation results in higher PLA2G2A mRNA levels measured by real-time PCR. (C) IL32 and PLA2G2A were downregulated individually or in combination in primary hepatocyte spheroids and PLA2G2A levels were measured by human PLA2G2A ELISA in the culture medium. PLA2G2A levels were higher after IL32 downregulation and lower after co-downregulation of IL32 and PLA2G2A . (D) After 2 days from seeding, hepatocyte spheroids were incubated with 10, 25, and 50 nM human recombinant IL-32β for 5 days. PLA2G2A was measured from cell culture supernatant using human PLA2G2A ELISA and we observed a dose dependent decrease in secreted PLA2G2A levels with increasing concentration of IL-32β. The p values were calculated by test for linear trend. (E) Lipid fingerprint measured by liquid chromatography- quadrupole time-of-flight-mass spectrometry demonstrated lower total PI and triglycerides (top) levels after IL32 downregulation. There was a reduction in all PI species, except 40:5 and 40:6, with the largest effect size in 38:4 (bottom). For each part, data are shown as mean ± SD of the reported independent experiments. Two-sided p values calculated with unpaired t test for n = 3 and Mann-Whitney non-parametric t test for n > 3. Cer, ceramides; CL, cardiolipins; DAG, di-acylglycerides; GalCer, galactosyl ceramides; LPC, lysophosphatidylcholine; ORO, Oil Red O; PE, phosphatidylethanolamine; PG, phosphatidylglycerol; RFU, relative fluorescence units; RU, relative units; PC, phosphatidylcholine; SM, sphingomyelin; TAG, triacylglycerols.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Cell Culture, Incubation, Negative Control, Marker, Staining, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Recombinant, Concentration Assay, Liquid Chromatography, Mass Spectrometry, MANN-WHITNEY, Fluorescence
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet: IL-32 rs76580947 minor allele associates with lower IL-32 expression, severe liver steatosis, and lower liver non-invasive tests (A) Regional plots of association between IL32 common genetic variants (minor allele frequency of >0.01) and ALT in the European subset of UK biobank. The x axis shows the variant positions (GRCh37); the y axis shows the –log10 p values. The gray diamond represents rs76580947, with the strongest association in the plotted region (IL-32 ± 50 Kbp), for which its pairwise LD with other variants is color coded as shown on the figure. (B) The association between rs76580947 and hepatic IL-32 mRNA levels was tested in 207 individuals from the MAFALDA cohort adjusting for age, gender, percentage of coding bases (a quality control measure from the Picard toolkit), RNA Integrity Number (RIN), and five surrogate variables detected by surrogate variable analysis. Carriers of the variant have lower IL-32 mRNA levels. Data shown as violin plots and adjusted p values are reported. (C) The association between IL32 rs76580947 stratified by genotype and IL-32 plasma protein level in 365,495 European participants from UK Biobank was tested using a linear regression analysis adjusted for age, gender, body mass index, first 10 genomic principal components, and array batch. Violin plot shows the normalized Protein eXpression (NPX) values that were rank-based inverse normal transformed prior to the analysis. (D) Forest plot of association and meta-analysis for IL32 rs76580947 with steatosis in three independent cohorts: Southern Italy (N = 425), Central Italy (N = 245), and Finnish (N = 745). The plot shows protection against severe liver steatosis (steatosis absence or mild vs. severe; fixed-effect p = 0.027). The association was tested by a binary logistic regression analysis under an additive genetic model adjusted by age, gender, body mass index, and recruitment center (only for the Finnish cohort). Pooled effect estimates were calculated using inverse-variance-weighted fixed effects meta-analysis. (E) The association between IL32 rs76580947 and clinical liver fibrosis scores and APOB levels in 365,495 European participants from UK Biobank. The analysis was performed under an additive model, using linear regression adjusting for age, gender, body mass index, the first 10 genomic principal components, and array batch. All traits were rank-based inverse normal transformed prior to the analysis. CI, confidence interval.
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Expressing, Variant Assay, Control, Clinical Proteomics, Transformation Assay
Journal: Cell Reports Medicine
Article Title: IL32 downregulation lowers triglycerides and type I collagen in di-lineage human primary liver organoids
doi: 10.1016/j.xcrm.2023.101352
Figure Lengend Snippet:
Article Snippet: After 24 h of seeding, HepG2 and HepaRG cells were exposed to human recombinant IL32α (3040-IL; R&D Systems),
Techniques: Recombinant, Protein Extraction, Staining, Western Blot, Reverse Transcription, Enzyme-linked Immunosorbent Assay, Transfection, Gene Expression, Fluorescence, Software, Cell Counting
Journal: The Journal of investigative dermatology
Article Title: IL-32 Supports the Survival of Malignant T Cells in Cutaneous T-cell Lymphoma.
doi: 10.1016/j.jid.2022.01.009
Figure Lengend Snippet: Figure 2. IL-32 induces CD14D APC that support malignant T-cell survival. (a) Survival of purified T cells versus PBMC from a patient with stage IV CTCL after culture with IL-32 and submitogenic IL-2. (b) IL-32b supported the survival of malignant and benign T cells and CD14þ myeloid cells. Five additional donors showed similar results. (c, d) HTS confirmed the persistence of malignant T cell TCRs in culture. (e) IL-32b enhanced the survival of benign and malignant T cells. (f, g) IL-32b induced the formation of large, activated CD14þ T cells. Similar results were observed in five additional donors. (h) The number of surviving malignant T cells was directly proportional to the number of IL-32beinduced large CD14þ cells. (i) IL-32b enhanced malignant T-cell survival by reducing apoptosis (detected by SYTOX Green). APC, antigen-presenting cell; cyt, cytokine; HTS, high throughput TCR sequencing.
Article Snippet: A total of 300,000e1,000,000 cells in 200 ml per well were cultured in round-bottom 96-well plates in the presence or absence of IL-2 (25 IU/ml, National Cancer Institute, Bethesda, MD), IL-32a (25 ng/ml; number 3040-IL-050, R&D Systems),
Techniques: High Throughput Screening Assay, Sequencing